The DNA strand, 5′- ATCGAATTCGTCGCTGAATTCGCCTAACTCCCGTGCCTATATATGGAATTCGCT-3, is cut with a restriction enzyme at the restriction site 5′-GAATTC-3′. The enzyme makes a staggered cut between the two T’s of the restriction site. Based on this information, write the DNA sequences of the resulting DNA fragments.
Place this order or similar order and get an amazing discount. USE Discount code “GET20” for 20% discount
